View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_14 (Length: 435)
Name: NF11626_high_14
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 31802058 - 31801785
Alignment:
| Q |
19 |
tgacaaccacaccggaataaattatcatagcaagtaaaagggttacttatcacaaatcctattcatatggaactaccagaagtccagaactcattttact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31802058 |
tgacaaccacaccggaataaattatcataggaagtaaaagggttacttgtcacaaatcctattcgtatggaactaccagaagtccagaactcattttact |
31801959 |
T |
|
| Q |
119 |
catagaatcacccattagaattagaaaatgcataactatcaaacaaaagaaggnnnnnnnnnctattttcatcccatgaggaaccttaccctttattcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801958 |
catagaatcacccattagaattagaaaatgcataactatcaaacaaaagaa-gaaaaaaaaactattttcatcccatgaggaaccttaccctttattcaa |
31801860 |
T |
|
| Q |
219 |
tttccaaaacaaaacacacaataagacttaactggttccactagaacatgcatatttgttttaaacatgttaacca |
294 |
Q |
| |
|
|||||||||||||| |||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801859 |
tttccaaaacaaaatacacaataagactt-attgattccactagaacatgcatatttgttttaaacatgttaacca |
31801785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University