View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_18 (Length: 351)
Name: NF11626_high_18
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 10768803 - 10768463
Alignment:
| Q |
1 |
tcaaagggtgaaagtagtattgatgactcgagaagcatgtttagcgctcaatctgaacggtatcgaagatatagtagcattgcaggatcatcggtaagag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10768803 |
tcaaagggtgaaagtagtatcgatgactcgagaagcatgtttagcgctcaatctgaacggtatcgaagatatagtagcattgcaggatcatcggtaagag |
10768704 |
T |
 |
| Q |
101 |
acgatgcaagcgttgaaagctcgccggtgtttcctagttacatggcactcactagttcagcaaaggcaaagtctagagtaatgcaaaaaacttcaccatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10768703 |
acgatgcaagcgttgaaagctcgccggtgtttcctagttacatggcactcactagttcagcaaaggcaaagtctagagtaatgcaaaaaacttcaccatc |
10768604 |
T |
 |
| Q |
201 |
accatcttcaatttctgcaaggaagaggctttctttccctgcttctccagttggttcgagacggcactctggtccacctaaggtggaaatataagagtta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10768603 |
accatcttcaatttctgcaaggaagaggctttctttccctgcttctccggttggttcgagacggcactctggtccacctaaggtggaaatataagagtta |
10768504 |
T |
 |
| Q |
301 |
gcaagtgtgacaaccgacactttagattgaagatgtctctg |
341 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
10768503 |
gcaagtgtagcaaccgacacttcagattgaagatgtctctg |
10768463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University