View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_19 (Length: 344)
Name: NF11626_high_19
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 9 - 329
Target Start/End: Original strand, 10553941 - 10554260
Alignment:
| Q |
9 |
aggtcggacctagtaggtagtcaatcaagcctagaccctcggtgtatattattttgggggaaaaagtgaatgaataagggttagcttgagatttctatat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10553941 |
aggtcggacctagtaggtagtcaatcaagcctagaccctcggtgtatattattttgggggaaaaagtgaatgaataagggttagcttgagatttctatat |
10554040 |
T |
 |
| Q |
109 |
ataggagataagagaaagagatgattagggttctcttctttatggatctttgactcgggggttactcccatgtcgctactattgatgtgctttaatgtct |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554041 |
ataggagataaga------gatgattagggttctcttctttatggatctttgactcgggggttactcccatgtcgctactattgatgtgctttaatgtct |
10554134 |
T |
 |
| Q |
209 |
ttataaatattctctatcgtgatgtgatccttgttagtctacaaggatgttgggtgtagtctcttgccatggct-----gtatgaatgtggagctggttc |
303 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
10554135 |
ttatatatattctctatcgtgatgtgatccttgttagtctacaaggatgttgggtgtagtctcttgccatggctctagagtatgaatgtggagctggatc |
10554234 |
T |
 |
| Q |
304 |
atcttgtatacctgaggagcaaatat |
329 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
10554235 |
atcttgtatacctgaggaggaaatat |
10554260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University