View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_23 (Length: 314)
Name: NF11626_high_23
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 32796811 - 32796753
Alignment:
| Q |
1 |
gaatgactagatgaggtaggtccactaattaccaagtgttgttggatctgagagccttt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32796811 |
gaatgactagatgaggtaggtccactaattaccaagtgttgttggatctgagagccttt |
32796753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University