View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_28 (Length: 282)
Name: NF11626_high_28
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 10768840 - 10769103
Alignment:
| Q |
1 |
attgtgaatggtttgccttcttgatttttggctaactggggaaggtttgttatcataaggaagaatataatttggctttgatgaactcttaatagatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10768840 |
attgtgaatggtttgccttcttgatttttggctaactggggaaggtttgttatcataaggaagaatataatttggctttgatgaactcttaatagatgga |
10768939 |
T |
 |
| Q |
101 |
tgatcattgtgattcataatgatgttttcggcttcccaaggtcgagtcgccatccatctctccaaccaactccatccccagtgaggattgcttggatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10768940 |
tgatcattgtgattcataatgatgttttcggcttcccaaggtcgagtcgccatccatctctctaaccaactccatccccagtgaggattgtttggatcca |
10769039 |
T |
 |
| Q |
201 |
taaatgtttggtttatagattttgaagaattcttccatgtttgctgttagagtaacacattata |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10769040 |
taaatgtttggtttatagattttgaagaattcttccatgtttgctgttagagtaacacattata |
10769103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University