View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_35 (Length: 247)
Name: NF11626_high_35
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 147 - 237
Target Start/End: Original strand, 8892854 - 8892944
Alignment:
| Q |
147 |
ttcaagattttttcttacacttgtttgtactttatattcttccatatcttagtcaaatgaaaagattacacaattataatcatgcaattca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8892854 |
ttcaagattttttcttacacttgtttgtactttatattcttccatatcttagtcaaatgaaaatattacacaattataatcatgcaattca |
8892944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 8892722 - 8892815
Alignment:
| Q |
1 |
catcaaacacttgtactaa-cctaaatggtggtttcccatactcgtcacattgcacaatgtgtggctttaagtactttataaccatcttgtctt |
93 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8892722 |
catcaaacacttgtactaaacctaaatggtgttttcccatactcgtcacattgcacaatgtgtggctttaagtactttataaccatcttgtctt |
8892815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University