View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_38 (Length: 240)
Name: NF11626_high_38
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 8892631 - 8892410
Alignment:
| Q |
1 |
tataattctacgtatgatatttggatcttggacagttggaatcacttacaattttcaactatgtttgcgtcagttgagtttgtta-ttacgactttcaac |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
8892631 |
tataattttacgtatgatatttggatcttggacagttggaatcacttacaattttcaactatgtttgcgtcagttgagtttgttacttacgattttcaac |
8892532 |
T |
 |
| Q |
100 |
tatgtttgtgtaagttgagttcgtatgcatgcatgggtttccatgaagcaaactaaaataaaaagaatacttgcctctaactatcataaagtgctttgtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8892531 |
tatgtttgtgtaagttgagttcgtatgcatgcatgggttttcatgaagcaaactaaaataaaaagaatacttgcctctaactatcataaagtgctttgtt |
8892432 |
T |
 |
| Q |
200 |
ttaataaaaagccaaagagaag |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
8892431 |
ctaataaaaaaccaaagagaag |
8892410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University