View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_46 (Length: 220)
Name: NF11626_high_46
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 11137528 - 11137341
Alignment:
| Q |
15 |
gatgaaagtgcaacgtgctcttccgaatgtatgagcacctacatttgaagcatatatattagccttataatttgttattatatacatgataacgaagtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11137528 |
gatgaaagtgcaacgtgctcttccgaatgtatgagcacctacatttgaagcatatatattagccttataatttgttattatatacatgataacgaagtga |
11137429 |
T |
 |
| Q |
115 |
ttcaagcacttttaattagaaaacatcgcatacctgagagagcaactagatcagtagtactgaggccttgagcagcaaatgcagattt |
202 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11137428 |
ttcgagcacttttaattagaaaacattgcatacctgagagagcaactagatcagtagtactgaggccttgagcagcaaatgcagattt |
11137341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 143 - 198
Target Start/End: Complemental strand, 11145715 - 11145660
Alignment:
| Q |
143 |
catacctgagagagcaactagatcagtagtactgaggccttgagcagcaaatgcag |
198 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11145715 |
catacccgagagtgcaactagatcagtagtactgaggccttgagaagcaaatgcag |
11145660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 198
Target Start/End: Complemental strand, 11149650 - 11149595
Alignment:
| Q |
143 |
catacctgagagagcaactagatcagtagtactgaggccttgagcagcaaatgcag |
198 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11149650 |
catacccgagagtgcaaccagatcagtagtatcgagaccttgagcagcaaatgcag |
11149595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 198
Target Start/End: Complemental strand, 11156340 - 11156292
Alignment:
| Q |
150 |
gagagagcaactagatcagtagtactgaggccttgagcagcaaatgcag |
198 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||| |||| |||||||| |
|
|
| T |
11156340 |
gagagtgcaactagatcagtagtattcaggccttgggcagtaaatgcag |
11156292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University