View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_high_9 (Length: 481)
Name: NF11626_high_9
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 449; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 449; E-Value: 0
Query Start/End: Original strand, 18 - 466
Target Start/End: Original strand, 5221021 - 5221469
Alignment:
| Q |
18 |
atttaacgctctaactaacggtttaatagctccggaagaagctattagttctttattttcgtcgcacaaagagagattcaaaatcgcggtaacaccgtat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221021 |
atttaacgctctaactaacggtttaatagctccggaagaagctattagttctttattttcgtcgcacaaagagagattcaaaatcgcggtaacaccgtat |
5221120 |
T |
 |
| Q |
118 |
tcttgaagttgcaggtcctgtgaagtaactaacgaaattaacggtttaattgcgccagctttagcgattttgattcgattttcaggtttattcttggcga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221121 |
tcttgaagttgcaggtcctgtgaagtaactaacgaaattaacggtttaattgcgccagctttagcgattttgattcgattttcaggtttattcttggcga |
5221220 |
T |
 |
| Q |
218 |
gtaatcgaatttccatagcggcttgtttctgctcttcgattgaatcggagtgaagatcggagacaagttgacggatgaggtcatcggaattttcggaagc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221221 |
gtaatcgaatttccatagcggcttgtttctgctcttcgattgaatcggagtgaagatcggagacaagttgacggatgaggtcatcggaattttcggaagc |
5221320 |
T |
 |
| Q |
318 |
gcaggcgaggaagagccgtcgggaggtagaagaagtggtggcgaattcgccggatctgtcactgttgcagtcgctgaaagcggaggaagttgaatcatcg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221321 |
gcaggcgaggaagagccgtcgggaggtagaagaagtggtggcgaattcgccggatctgtcactgttgcagtcgctgaaagcggaggaagttgaatcatcg |
5221420 |
T |
 |
| Q |
418 |
ttgatggagaattcgttgaaacttcgtcccatgtatgtgtaactctctg |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221421 |
ttgatggagaattcgttgaaacttcgtcccatgtatgtgtaactctctg |
5221469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 401
Target Start/End: Complemental strand, 47469477 - 47469431
Alignment:
| Q |
355 |
gtggcgaattcgccggatctgtcactgttgcagtcgctgaaagcgga |
401 |
Q |
| |
|
|||| ||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
47469477 |
gtggtgaattcggtggatctgtcactgtcgcagtcgctgaaagcgga |
47469431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University