View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11626_low_23 (Length: 314)

Name: NF11626_low_23
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11626_low_23
NF11626_low_23
[»] chr5 (1 HSPs)
chr5 (1-59)||(32796753-32796811)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 32796811 - 32796753
Alignment:
1 gaatgactagatgaggtaggtccactaattaccaagtgttgttggatctgagagccttt 59  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32796811 gaatgactagatgaggtaggtccactaattaccaagtgttgttggatctgagagccttt 32796753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University