View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_low_40 (Length: 237)
Name: NF11626_low_40
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 29144495 - 29144709
Alignment:
| Q |
14 |
gagaacaacacgtaatgaaagtaaacaacaaaaccattgaaatgctgacacaaactagttctcctctaatgcatagcacctgtcaccaaatatctttann |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29144495 |
gagaacaacacgtaatgaaagtaaacaacaaaaccattgaaatgctgacacaaactagttctcctctaatgcatagcacctgtcaccaaatatctttatt |
29144594 |
T |
|
| Q |
114 |
nnnnnnn----caatttatttgcagcatttatttctacaactgacttttgtttttatcatagcaaaactattcaaataccaagccaaataattatggcct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29144595 |
ttttttttcttcaatttatttgcagcatttatttctacaactgacttttgtttttatcatagcaaaactattcaaataccaagccaaataattatggcct |
29144694 |
T |
|
| Q |
210 |
cgatcttatatttga |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29144695 |
cgatcttatatttga |
29144709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University