View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_low_42 (Length: 232)
Name: NF11626_low_42
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 35367099 - 35367299
Alignment:
| Q |
15 |
gcacgttggacctcaaatttgttataatatttcaagtgaagcactaagcacttattgcaatatttatttatgctatttcctccttcataattcattttct |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35367099 |
gcactttggacctcaaatttgttataatatttcaagtgaagcacta-gcacttattgcaatatttatttatgctatttcctccttcataattcattttct |
35367197 |
T |
 |
| Q |
115 |
tttattgttttactaaacacttaatcatcccaaaattacattaatctattttaatatgtatctaggatagacagtgaagatgtatacaaagtatagtaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35367198 |
tttattgttttactaaacacttaatcatcccaaaattacattaatctattttaatatgtatctaggatagacaatgaagatgtatacaaagtatggtaat |
35367297 |
T |
 |
| Q |
215 |
aa |
216 |
Q |
| |
|
|| |
|
|
| T |
35367298 |
aa |
35367299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University