View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_low_45 (Length: 226)
Name: NF11626_low_45
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 31696480 - 31696301
Alignment:
| Q |
1 |
aatgaagtataacgttacaatttcataaatgtggtagtgatttgttgaggtcatgttgttgcaaattatatatctgaatgtttcaaatgaataatctctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31696480 |
aatgaagtataacgttacaatttcataaatgtggtagtgatttgttgaggtcatgttgttgcaaattatatatctaaatgtttcaaatgaataatctctg |
31696381 |
T |
 |
| Q |
101 |
gatgagtcgtaaaatattcatcttgtgatccaggaatattgaatatcacatgatgatcattcttgaattgtgtagtctata |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31696380 |
gatgagtcgtaaaatattcatcttgtgatccaggaatattgaatatcacatgatgatcattcttg-attgtgtagtctata |
31696301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 226
Target Start/End: Complemental strand, 31695696 - 31695652
Alignment:
| Q |
182 |
ttgctatccacttaaatatggttacaaaaacaattaatatttcaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31695696 |
ttgctatccacttaaatatggttacaaaaacaattaatatttcaa |
31695652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University