View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11626_low_47 (Length: 206)
Name: NF11626_low_47
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11626_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 35034723 - 35034913
Alignment:
| Q |
1 |
caccaccatctgcattgcctatggttcaccctctccctccttttcaccaatatggctatataccttatggtatgaattacggttggcctaataccatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034723 |
caccaccatctgcattgcctatggttcaccctctccctccttttcaccaatatggctatataccttatggtatgaattacggttggcctaataccatgat |
35034822 |
T |
|
| Q |
101 |
gtggcctttattaaacatgtcgggcaataccatgatgcaacctttcttgaacatgacgggtaacaccatgatgcaaccttacagacccata |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034823 |
gtggcctttattaaacatgtcgggcaataccatgatgcaacctttcttgaacatgacgggtaacaccatgatgcaaccttacagacccata |
35034913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University