View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11628_high_18 (Length: 241)
Name: NF11628_high_18
Description: NF11628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11628_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 38902268 - 38902370
Alignment:
| Q |
1 |
atttggctgtaatatgttgtaattcaaacttatcagcttggtttttactttgaatgcacacacaattacaaaaatatattcacaatccaaaagttatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38902268 |
atttggctgtaatatgttgtaattcaaacttatcaacttggtttttactttgaatgcacacacaattacaaaaatatattcacaatccaaaagttatctt |
38902367 |
T |
|
| Q |
101 |
act |
103 |
Q |
| |
|
||| |
|
|
| T |
38902368 |
act |
38902370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 38902441 - 38902485
Alignment:
| Q |
179 |
tagtagtatatggtgttgaaggttacccggctgagacctctgaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38902441 |
tagtagtatatggtgttgaaggttacccggctgagacctctgaaa |
38902485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University