View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11628_low_13 (Length: 278)
Name: NF11628_low_13
Description: NF11628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11628_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 44973940 - 44974189
Alignment:
| Q |
19 |
cttcaaacattgtacaccaannnnnnnaaactacatcctcaaagatgtttccctcacagcatacccttctgagattcttgccattgttggtccaagtggt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44973940 |
cttcaaacattgtacaccaacccccccaaactacatcctcaaagatgtttccctcacagcatacccttctgagattcttgccattgttggtccaagtggt |
44974039 |
T |
 |
| Q |
119 |
gcaggaaaatcaactcttctagacattctttcagctagaagattacccttaagtggtacactttcccttaactcttcacctatcactaacccttccacat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
44974040 |
gcaggaaaatcaactcttctagacattctttcagctagaagattacccttaagtggtacactttctcttaactcttcacctatcactaacccttctacat |
44974139 |
T |
 |
| Q |
219 |
tcagaaaactctctgcttatgttcctcaacatgatgcatgtcttcctatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974140 |
tcagaaaactctctgcttatgttcctcaacatgatgcatgtcttcctatg |
44974189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University