View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11628_low_9 (Length: 364)
Name: NF11628_low_9
Description: NF11628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11628_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 15 - 347
Target Start/End: Complemental strand, 4394160 - 4393828
Alignment:
| Q |
15 |
gatggtggaggaagtagtaggatgtaaaacagtagtagtagttgtggcnnnnnnnaaacagatgttcagatgtnnnnnnntttggtgcattatttttacg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| || |
|
|
| T |
4394160 |
gatggtggaggaagtagtaggatgtaaaacagtagtagtagttgtggcgggtggcaaacagatgttcagatgtggggggatttggtgcattattttcaca |
4394061 |
T |
 |
| Q |
115 |
gacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatgatctcactaagcaggaaactggtagtgcaattaccagtgttatggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394060 |
gacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatgatctcactaagcaggaaactggtagtgcaattaccagtgttatggt |
4393961 |
T |
 |
| Q |
215 |
gttgctgaccatgtgattgagcaggaaccatgttggaaagttcagagaagcaaaacccttgtgatgtaacattgttaggaagcactattccttgtccatg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4393960 |
gttgctgaccatgtgattgagcaggaaccatgttggaaagttcagagaagcaaaacccttgtgatgtaacattattaggaagcactattccttgtccatg |
4393861 |
T |
 |
| Q |
315 |
atgttgcaccgggaagaagaaagtctcggtagt |
347 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
4393860 |
atgttgcaccgggaagaagaaagtctcagtagt |
4393828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University