View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11629_low_18 (Length: 250)
Name: NF11629_low_18
Description: NF11629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11629_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 10281589 - 10281832
Alignment:
| Q |
1 |
atatgccccaaaggctgattcaagctcagtaaattgagcttgctttctatttcttgagcgttattagagagcattctaaaaggcagtgtcattagatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281589 |
atatgccccaaaggctgattcaagctcagtaaattgagcttgctttctatttcttgagcgttattagagagcattctaaaaggcagtgtcattagatatt |
10281688 |
T |
|
| Q |
101 |
aagatcatgtttggagaaacaatttaattaaacaaaatagcacatgcgtttatcatgtcctatgagaaacacattgaactcctagaattgttactctttt |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281689 |
aagatcatgtttggataaacaatttaattaaacaaaatagcacatgcgtttatcatgtcctatgagaaacacattgaactcctagaattgttactctttt |
10281788 |
T |
|
| Q |
201 |
gtcattttgcatcagaggagtgttcctgtctccattcatctctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281789 |
gtcattttgcatcagaggagtgttcctgtctccattcatctctc |
10281832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 47544209 - 47544169
Alignment:
| Q |
148 |
gtttatcatgtcctatgagaaacacattgaactcctagaat |
188 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
47544209 |
gtttatcatgtcgtatgtgaaacatattgaactcctagaat |
47544169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University