View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1162_high_6 (Length: 261)
Name: NF1162_high_6
Description: NF1162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1162_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 44 - 261
Target Start/End: Original strand, 49531361 - 49531578
Alignment:
| Q |
44 |
gtgatttgatcatgtaatatctttttgtgtcatgtggaaacacgatagcacttagccttttggaccaagcatccaattagaatgggcaaagaaccggtat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49531361 |
gtgatttgatcatgtaatatctttttgtgtcccgtggaaacacgatagcacttagccttttggaccaagcatccaattagaatgggcaaagaaccggtat |
49531460 |
T |
 |
| Q |
144 |
ggaacacaatatatttaagctaaaatataagtgtttggttgaaatcctataacatagttaatttaaaggataattatttggatcactacattagctatct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49531461 |
ggaacacaatatatttaagctaaaatataagtgtttggttgaaatcctatcacatagttaatttaaaggataattatttggatcactacattagctatct |
49531560 |
T |
 |
| Q |
244 |
agtcttacctaaaagcga |
261 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
49531561 |
agtcttacctaaaagcga |
49531578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University