View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1162_low_10 (Length: 357)
Name: NF1162_low_10
Description: NF1162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1162_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 185 - 279
Target Start/End: Original strand, 28963075 - 28963169
Alignment:
| Q |
185 |
agaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttttaactaattcat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
28963075 |
agaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaggaatgaattgctgaccttggatttttatctttcctttaactaattcat |
28963169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 186 - 279
Target Start/End: Complemental strand, 3442843 - 3442750
Alignment:
| Q |
186 |
gaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttttaactaattcat |
279 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||||||||||||||| |||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
3442843 |
gaaaaatgctttattgcacgagaacaaaccatgcacgacaacttacgaatgaattgctgcccttggatttttatctttccattaactaattcat |
3442750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 279
Target Start/End: Complemental strand, 24115931 - 24115842
Alignment:
| Q |
191 |
atgctttatggtacgagagcaaacc-atgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttttaactaattcat |
279 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |||||||||||| | |||| ||||||||||||| ||||| |||||||| |
|
|
| T |
24115931 |
atgctttatggtacgagaacaaacccatgcacgacaacttgcgaatgaattgcttcccttggatttttatctttcatttaattaattcat |
24115842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 4745246 - 4745392
Alignment:
| Q |
1 |
tggtaattgccaaatcaatgtttggagcttacatcccatattttaacctttgtaacttgctgattttgaaactcaaacgattgcacaatttctgtgatgg |
100 |
Q |
| |
|
||||||| |||||||||| ||||||| || |||||||||| ||||||||| ||| || || ||||| | ||| ||| |||||||||||| | |||| | |
|
|
| T |
4745246 |
tggtaatcgccaaatcaaagtttggacctcacatcccatactttaaccttcgtagctgactaattttcatactttaacaattgcacaatttatatgattg |
4745345 |
T |
|
| Q |
101 |
gcagagagataagtgagtagtaaatgaagtttagaacaattttaaag |
147 |
Q |
| |
|
|||||||||| |||| ||||||| |||||||| |||||| ||||||| |
|
|
| T |
4745346 |
gcagagagatgagtgggtagtaagtgaagtttggaacaactttaaag |
4745392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 186 - 263
Target Start/End: Complemental strand, 26683875 - 26683799
Alignment:
| Q |
186 |
gaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatcttt |
263 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||| ||| || ||||||||||||||||| |
|
|
| T |
26683875 |
gaaaaatgctttatggtacaagagcaaaccatgcacgacaacttgcaaatgaa-tgccgcccttgaatttttatcttt |
26683799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University