View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_high_11 (Length: 287)
Name: NF11630_high_11
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 48819120 - 48819386
Alignment:
| Q |
1 |
actttttgtatagaaggatgatcttttaatggagttttgttctttaattcgtgtgataactttgtttttcagaactcggttacggacacttggttttgaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
48819120 |
actttttgtatagaaggaggatcttttaatggagttttgttctttaatttgtgtgataactttgttttccagaactcggttgcggacacttggttttgaa |
48819219 |
T |
 |
| Q |
101 |
aaattgacccaaaacatggttataccgtca----aatatataatatatt-atttctgaatagcaacatgtttattctcctttcacaggcatcgtatggaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48819220 |
aaattgacccaaaacatggttataccgtcaaaggaatatataatatgttgatttctgaatagcaacatgtttattctcctttcacagacatcgtatggaa |
48819319 |
T |
 |
| Q |
196 |
taaaccggtgcttctcaaagtctctctctttgtgcgacaattatttgataaaaggataccgagaaaa |
262 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48819320 |
taaatcggtgcttctcaaagtctctctctttgtgcgacaattatttgataaaaggataccgagaaaa |
48819386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University