View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_high_18 (Length: 235)
Name: NF11630_high_18
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14708778 - 14708555
Alignment:
| Q |
1 |
tagcgtccgcacgacgcggcggttagcatccattttttgggttgaaaggagagagaggaaaaaacgtgtaagagnnnnnnngtttaagaagattgtatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14708778 |
tagcgtccgcacgacgcggcggttagcgtccatattttgggttggaaggagagagaggaaaaaacgtgtaagagtttttttgtttaagaagattgtatga |
14708679 |
T |
 |
| Q |
101 |
gtgggttttagaaagattgcaattgcaacttggaaagggcaacacgtcttaataataagactttattattgttgatgttatgaccaatagtcatggtggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14708678 |
gtgggttttagaaagattgcaattgcaacttggaaagggcaacacgtcttaataataagactttattattgttgatgttatgaccaatagtcatggtggt |
14708579 |
T |
 |
| Q |
201 |
ttcatacatgttatagttgttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14708578 |
ttcatacatgttatagttgttttt |
14708555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University