View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11630_high_19 (Length: 234)

Name: NF11630_high_19
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11630_high_19
NF11630_high_19
[»] chr8 (1 HSPs)
chr8 (12-218)||(7623009-7623214)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 7623214 - 7623009
Alignment:
12 tagaagcataggatagggcaattgataccatttatagtgtttaccacacactaccctttccgattatggaaactatatatgcacttcaccctatacatta 111  Q
    |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
7623214 tagatgcataggatagggcaattgataccatttatagtgattaccacacactaccctttccgattatggaaactatatacgcacttcaccctatacatta 7623115  T
112 agaattgggaatgaaatcgtggacatgtatcgtccaggcatagtgaagtagttataattattgtttgactatatgttaatgttaataatcactttcatgg 211  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||    
7623114 agaattggggatgaaatcgtggacatgtatcgtccaggcatagtgaagtagtgataattattgtttgactatatgttaatg-tagtaatcactttcatgg 7623016  T
212 atacata 218  Q
    |||||||    
7623015 atacata 7623009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University