View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_high_20 (Length: 201)
Name: NF11630_high_20
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 365864 - 366033
Alignment:
| Q |
18 |
aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagatttggcgccattgttgatgagactgtggacatttgaggttatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
365864 |
aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagattcggcgtcattgttgatgagactgtggacatttgaggttatgg |
365963 |
T |
 |
| Q |
118 |
ttttgaatttgttgacgaaatggaagtcgtcggaagaaattaggaggctaatgagattagggtgtttttg |
187 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365964 |
ttttgaatttgttgacgaaatggaaatcgtcagaagaaattaggaggctaatgagattagggtgtttttg |
366033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University