View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_high_6 (Length: 319)
Name: NF11630_high_6
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 19 - 139
Target Start/End: Original strand, 31300616 - 31300733
Alignment:
| Q |
19 |
gacacgttgctttattctacaagaaacgattaagtggtcaagaatagttaattgtaaaaagaaaataagtataacactaaaacacaagtacatgcgacaa |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
31300616 |
gacacgttgctttattctacaggaaacgattaagtggtcaagaataattaattgtaaa---aaaaaaaatataacactaaaacacaagtacatgcgacaa |
31300712 |
T |
|
| Q |
119 |
gtactgaagtacatgtcatgc |
139 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31300713 |
gtactgaagtacatgtcatgc |
31300733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 213 - 312
Target Start/End: Original strand, 31300986 - 31301084
Alignment:
| Q |
213 |
aatctaaaactaagcatgcatgcgacaagtacatgccatgcttttaatccgnnnnnnncacctgtcatgcttgatcactgactaaatacgtttcatctct |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
31300986 |
aatctaaaactaagcatgcatgcgacaagtacatgccatgcttttaatccgaaaaaaacacctgtcatgcttgatca-tgactaaatacgtttaatctct |
31301084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University