View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_high_8 (Length: 316)
Name: NF11630_high_8
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 174 - 299
Target Start/End: Complemental strand, 40682065 - 40681940
Alignment:
| Q |
174 |
attgagaagtggttaacttatattctgaaaactttcattttatttattctttaaccaaaactcttggtgcattcatcagcaaaaacccaactagatcaag |
273 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40682065 |
attgaaaagtggttaacttatattctgaaaactttcattttatttattctttaatcaaaactcttggtgcattcatcaggaaaaatccaactagatcaag |
40681966 |
T |
 |
| Q |
274 |
taaattagaacttcatggagagaatt |
299 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40681965 |
taaattagaacttcatggagagaatt |
40681940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 298
Target Start/End: Complemental strand, 34706877 - 34706824
Alignment:
| Q |
243 |
cattcatcagcaaaaacccaactagatcaagtaaattagaacttcatggagagaat |
298 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34706877 |
cattcatcagcaaaa-cccaactagatcaagtaaattagatctt-atggagagaat |
34706824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University