View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_low_10 (Length: 301)
Name: NF11630_low_10
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 52248449 - 52248219
Alignment:
| Q |
17 |
aaaaaatacgctgcgaaatgtgatttgaaagttcatatgaagagctgtggaactagagagtataaatgtgattgtggcacagtgttttctaggttaattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52248449 |
aaaaaatacgctgcgaaatgtgatttgaaagttcatatgaagagctgtggaactagagagtataaatgtgattgtggcacagtgttttctaggttaattt |
52248350 |
T |
 |
| Q |
117 |
cttttccatc----tttaattatctctcaaaatattgatcattttctgttttgttaatgttatctatttgtttataggaaggataattttgttacgcaca |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52248349 |
cttttccatcgatctttaattatctctcaaaatattgattattttctgttttgttaatgttatttatttgtttataggaaggataattttgttacgcaca |
52248250 |
T |
 |
| Q |
213 |
gaaggttctgcgatggaatggtgaatgagag |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52248249 |
gaaggttctgcgatggaatggtgaatgagag |
52248219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 37 - 97
Target Start/End: Complemental strand, 22085580 - 22085520
Alignment:
| Q |
37 |
tgatttgaaagttcatatgaagagctgtggaactagagagtataaatgtgattgtggcaca |
97 |
Q |
| |
|
||||| ||||| ||||| |||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22085580 |
tgattggaaagctcatagcaagatttgtggaactagagagtacaaatgtgattgtggcaca |
22085520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University