View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_low_12 (Length: 260)
Name: NF11630_low_12
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 3482995 - 3482743
Alignment:
| Q |
1 |
aataaaaaggcctatagcccttaacaataagagaattaaaatcttctaggaattaaaatatcaagtttgaaaagctccaccaacggattatttatccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3482995 |
aataaaaaggcctatagcccttaacaataagagaattaaaatcgtctaggaattaaaatatcaagtttgaaaagctccaccaacgaattatttacccttt |
3482896 |
T |
|
| Q |
101 |
cactctttttcaactctcaaacaaagtcttaagaaataattatagtttttaactatacttctgatttttatatttgttatcctcactgtgctacgatgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3482895 |
tactctttttcaactctcaaacaaagtcttaagaaataattgcagtttttaactatacttctgatttttatatttgttatcctcactgtgctacgatgag |
3482796 |
T |
|
| Q |
201 |
tactttcctccacaccactcatttcaacttcaacctttggtgtccgccctttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3482795 |
tactttcctccacaccactcatttcaacttcaacctttggtgtccgccctttg |
3482743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University