View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_low_16 (Length: 238)
Name: NF11630_low_16
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 51 - 202
Target Start/End: Original strand, 3483414 - 3483564
Alignment:
| Q |
51 |
aattcataaaagtgttaaatatgtatgtttagtctctgacgnnnnnnnnnntgcaatcatgtttatttctcaatttggtgctttttggacaacttatatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3483414 |
aattcataaaagtgttaaatatgtatgtttagtctcagacgaaaaaaaaa-tgcaatcatgtttatttctcaatttggtgctttttggacaacttatatg |
3483512 |
T |
 |
| Q |
151 |
catgaatattttcatcaaaaccagcaaattaaagactaaccttcaatgaaac |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3483513 |
catgaatattttcatcaaaagcagcaaattaaagactaaccttcaatgaaac |
3483564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 3483017 - 3483056
Alignment:
| Q |
1 |
aagttctacaattcttgcatagacatattttataaaaggg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3483017 |
aagttctacaattcttgcatagacatattttataaaaggg |
3483056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University