View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_low_19 (Length: 234)
Name: NF11630_low_19
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 7623214 - 7623009
Alignment:
| Q |
12 |
tagaagcataggatagggcaattgataccatttatagtgtttaccacacactaccctttccgattatggaaactatatatgcacttcaccctatacatta |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7623214 |
tagatgcataggatagggcaattgataccatttatagtgattaccacacactaccctttccgattatggaaactatatacgcacttcaccctatacatta |
7623115 |
T |
 |
| Q |
112 |
agaattgggaatgaaatcgtggacatgtatcgtccaggcatagtgaagtagttataattattgtttgactatatgttaatgttaataatcactttcatgg |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
7623114 |
agaattggggatgaaatcgtggacatgtatcgtccaggcatagtgaagtagtgataattattgtttgactatatgttaatg-tagtaatcactttcatgg |
7623016 |
T |
 |
| Q |
212 |
atacata |
218 |
Q |
| |
|
||||||| |
|
|
| T |
7623015 |
atacata |
7623009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University