View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11630_low_20 (Length: 201)

Name: NF11630_low_20
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11630_low_20
NF11630_low_20
[»] chr1 (1 HSPs)
chr1 (18-187)||(365864-366033)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 365864 - 366033
Alignment:
18 aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagatttggcgccattgttgatgagactgtggacatttgaggttatgg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
365864 aagtaatgatttgagaaagtgagagtatggaaaatgtctatgagagctgtttgagattcggcgtcattgttgatgagactgtggacatttgaggttatgg 365963  T
118 ttttgaatttgttgacgaaatggaagtcgtcggaagaaattaggaggctaatgagattagggtgtttttg 187  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
365964 ttttgaatttgttgacgaaatggaaatcgtcagaagaaattaggaggctaatgagattagggtgtttttg 366033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University