View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11630_low_7 (Length: 316)
Name: NF11630_low_7
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11630_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 15113119 - 15112940
Alignment:
| Q |
19 |
catgtaccagaaaaaa-cgtgttgttacattcctaaaaagttcatctaannnnnnnggttaaattccgaatcagatgaagtagctatacacgtgatttag |
117 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15113119 |
catgtaccagaaaaaaacgggttgttacattcctaaaaagttcatctaattttttgggttagattccgaatcagatgaagtagctatacacgtgatttag |
15113020 |
T |
 |
| Q |
118 |
tacattataggtataatcattaattttgaaaaccttgtggatataattctagagctccagcaataaatattgttacatct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15113019 |
tacattataggtataatcattaattttgaaaaccttgtggatataattctagagctccagcaataaatatttttacatct |
15112940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University