View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11631_low_5 (Length: 221)
Name: NF11631_low_5
Description: NF11631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11631_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 31563941 - 31563750
Alignment:
| Q |
12 |
agcagagacggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31563941 |
agcagagacggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaa |
31563842 |
T |
|
| Q |
112 |
tggatagttcccactctcccaggaggaggattcaattcaaatggcgatccgacagcagcaaaagctcccatcgattgatttccttgcagtga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31563841 |
tggatagttcccactctcccaggaggaggattcaattcaaatggcgatccgacaacagcaaaagctcccatcgattgatttccttgcagtga |
31563750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University