View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11632_high_3 (Length: 362)
Name: NF11632_high_3
Description: NF11632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11632_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 20 - 356
Target Start/End: Complemental strand, 12683905 - 12683569
Alignment:
| Q |
20 |
attatatgctatctcaaagatcctcacacccttctacccctatgtatatattcaaaaatttgaaaaaaccaccaccacctaccaccaatgctgccggtgt |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12683905 |
attatatgctatatcaaagatcctcacacccttctacccctatgtatatattcaaaaatttgaaaaaaccaccaccacctaccaccaatgttgccggtgt |
12683806 |
T |
 |
| Q |
120 |
agttgccgccgcttactgccactttttacaacagtccatgcactcttttagcccctacctagagcctcattcaatgattaattacaatcattattttcat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683805 |
agttgccgccgcttactgccactttttacaacagtccatgcactcttttagcccctacctagagcctcattcaatgattaattacaatcattattttcat |
12683706 |
T |
 |
| Q |
220 |
tgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttcgtcctcgtcatcatcaccgtcatcatcgtcataatattcttctt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683705 |
tgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttcgtcctcgtcatcatcaccgtcatcatcgtcataatattcttctt |
12683606 |
T |
 |
| Q |
320 |
catctcgacgcggctgatcattctcagtctctgcttc |
356 |
Q |
| |
|
|||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
12683605 |
catctcgatgcggccgatcattctcagtctcagcttc |
12683569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University