View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11632_low_7 (Length: 311)
Name: NF11632_low_7
Description: NF11632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11632_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 42080583 - 42080783
Alignment:
| Q |
15 |
acatatcaattaaaaaatgttatagccctcgaatagatgttagtatctcgtatgattggtctttgcatataggtttaggtatctgaattcatctaacaat |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42080583 |
acatatcagttaaaaaatgttatagccctcgaatagatgttagtatctcgtatgattggtctttgcatatcggtttaggtatctgaattcatctaacaat |
42080682 |
T |
 |
| Q |
115 |
agacacttcatatcgaaggcatgtttgatatttaaatggcacatatggttacattcaatttttcaattttctcaatatactattatttacggatttcaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42080683 |
agacacttcatatcgaaggcatgttttatatttaaatggcacatatggttacattcaatttttcaattttctcaatatactattatttacggatttcaag |
42080782 |
T |
 |
| Q |
215 |
c |
215 |
Q |
| |
|
| |
|
|
| T |
42080783 |
c |
42080783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 200
Target Start/End: Original strand, 42071816 - 42071868
Alignment:
| Q |
148 |
aaatggcacatatggttacattcaatttttcaattttctcaatatactattat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
42071816 |
aaatggaacatatggttacattcaattaatcaattttctcaatttattattat |
42071868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University