View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11632_low_9 (Length: 250)
Name: NF11632_low_9
Description: NF11632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11632_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 8438675 - 8438432
Alignment:
| Q |
8 |
aagcagagaggatatgattttttatca-ttcccatactcttctttcccaatctcctccaactcttgtttctctgctttctcttctccgatggctacaatc |
106 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438675 |
aagcaaagaggatatgattttttatcaattcccatactcttctttcccaatctcctccaactcttgtttctctgctttctcttctccgatggctacaatc |
8438576 |
T |
 |
| Q |
107 |
aatttcatatgcaaaccctcaatcccttctataccaatttcattccctacccttcattcccttccttcttctctacctaaaattcattctcgtgtaggac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||| |
|
|
| T |
8438575 |
aatttcatatgcaaaccctcaatcccttctataccaatttcattccctacccttcattcccttccttcttctatacctaaaatttattctcgggtaggac |
8438476 |
T |
 |
| Q |
207 |
cctcttctaatctgcatctccagcagagacgacgtgttgttatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438475 |
cctcttctaatctgcatctccagcagagacgacgtgttgttatc |
8438432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University