View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11634_high_9 (Length: 428)
Name: NF11634_high_9
Description: NF11634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11634_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 12 - 412
Target Start/End: Complemental strand, 27399645 - 27399245
Alignment:
| Q |
12 |
tttgtttttatctctcttatttgagttactggatttattatccttacaggatcactttctgttctgagcttggaaattaaaacatgttacagtagggtaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27399645 |
tttgtttttatctctcttatttgagttactggatttattatccttacaggatcactttctgttctgagcttggaaattaaaacatgttacagtagggtaa |
27399546 |
T |
 |
| Q |
112 |
cattaaatagtggtgtgtatgcattgaatttaatgatctgttattttggttatgttatctagtggatgtggtttagggcagaagtgcagaagaaccacat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27399545 |
cattaaatagtggtgtgtatgcattgaatttaatgatgtgttattttggttatgttatctagtggatgtggtttagggcagaagtgcagaagaaccacat |
27399446 |
T |
 |
| Q |
212 |
ggaaagctcgatctgtcttgttgaaaatactagtttctgttggcattaaacattgtttttatgtagcttggtagatccatatcaactctgtaatatatac |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27399445 |
ggaaagctcgatctgtcttgttgaaaatactagtttctgttggcattaaacattgtttttatgtagcttggtagatccatatcaactctgtaatatatac |
27399346 |
T |
 |
| Q |
312 |
tagtatgtacattttcacttatacgggcttttaatagtgtgttcggtatccggtatcttggtccataagaccgagctcatactgcacagggataaccctg |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27399345 |
tagtatgtacattttcacttatacgggcttttaatagtgtgttcggtatccggtatcttggtccataagaccgagctcatactgcatagggataaccctg |
27399246 |
T |
 |
| Q |
412 |
a |
412 |
Q |
| |
|
| |
|
|
| T |
27399245 |
a |
27399245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University