View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11634_low_13 (Length: 373)
Name: NF11634_low_13
Description: NF11634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11634_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 6033795 - 6033974
Alignment:
| Q |
18 |
tggttgaaatggtcacgtcaaagatcacttataatcgatatgtgcgaacaccagacacattttaactnnnnnnnnnggatgattttaaagacttcttaca |
117 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| || |||| |||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
6033795 |
tggttgaattggtcacgttaaagatcacttatagtcaatatatgcgaacaccag-cacattttaaaaaaa--------aagattttaaagacttcttaca |
6033885 |
T |
 |
| Q |
118 |
attcttatgaccatccgccatatgtgcaagagttt-gaagggttcttaggattaaaattttgacttgttaatttttcattgatttttgc |
205 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033886 |
attctgatgaccatcggccatatgtgcaagagttttgaagggttcttaggattaaaattttgacttgttaatttttcattgatttttgc |
6033974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 256 - 356
Target Start/End: Original strand, 6034062 - 6034163
Alignment:
| Q |
256 |
tcccaacacatggtcattccaagtgtacta-atttattttatcatttgaacgaagtaaaatttcctgttaaaaaataattaaagaagggccagattcatt |
354 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||| || |
|
|
| T |
6034062 |
tcccaacacatggtgattctaattgtactatatttattttatcatttgaatgaagtaaaattccctgttaaaaattaattaaagaacggccagattcgtt |
6034161 |
T |
 |
| Q |
355 |
ag |
356 |
Q |
| |
|
|| |
|
|
| T |
6034162 |
ag |
6034163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University