View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11634_low_17 (Length: 299)
Name: NF11634_low_17
Description: NF11634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11634_low_17 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 50 - 299
Target Start/End: Complemental strand, 27400200 - 27399950
Alignment:
| Q |
50 |
tcacaagaagcaactttatccaaatatagaacatcttcttttataggttgtcttaaacaacctcaatttggttcaacatattttcaggtaatgccaacag |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27400200 |
tcacaagaagcaactttatccaaatatagaacatcttcttttataggttgtcttaaacaacctcaatttggttcaacatgttttcaggtaatgccaacag |
27400101 |
T |
|
| Q |
150 |
aaaat-aaaaatggcaattcacaacataatttacattttcacataacactacatatatggtactatttaagtgttgaatgttcaaacataagcattttca |
248 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27400100 |
aaaattaaaaatggcaattcacaacataatttacattttcacataacactacatatatggtactatttaagtgttgaatgttcaaacataagcattttca |
27400001 |
T |
|
| Q |
249 |
agttgttggaatgatctaatcttaacagatggatttcggaggcaagagtaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27400000 |
agttgttggaatgatctaatcttaacagatggatttcggaggcaagagtaa |
27399950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 27400299 - 27400260
Alignment:
| Q |
16 |
aggtattgagactctagctagacttaggtattgttcacaa |
55 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27400299 |
aggtattgatactctagctagacttaggtattgttcacaa |
27400260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University