View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11634_low_22 (Length: 241)
Name: NF11634_low_22
Description: NF11634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11634_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 50101750 - 50101540
Alignment:
| Q |
22 |
tcccactgttgttaacttgttatctctgtctgtctcttgtgttgcttttttcagtgtgcactctgactcactctttgccttctttttattttaaaacaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50101750 |
tcccactgttgttaacttgttatctctgtctgtctcttgtgttgcttttttcagtgtgcactctgactcactctttgccttctttttattttaaaacaaa |
50101651 |
T |
 |
| Q |
122 |
aattaaattattcatcaaaccctattccccaagctgacatgtgtctcacactgccatttccatcggataagatctccatggctcatgtcgttctttcatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
50101650 |
aattaaattattcatcaaaccctattccccaagctgacatgtgtctcacactgccatttccatcggataagatctccttggctcatgttgttctttcatt |
50101551 |
T |
 |
| Q |
222 |
ttcatctcact |
232 |
Q |
| |
|
|||| |||||| |
|
|
| T |
50101550 |
ttcaactcact |
50101540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University