View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11634_low_27 (Length: 204)
Name: NF11634_low_27
Description: NF11634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11634_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 38762582 - 38762749
Alignment:
| Q |
17 |
cacagagggttcaatatggggccactgcacgtgtatggatgattgtcatatactatctagctagattagaaaattttcaaattaagattaagatgcaatt |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762582 |
cacaaagggttcaatatggggccactgcacgtgtatggatgattgtcatatactatctagctagattagaaaattttcaaattaagattaagatgcaatt |
38762681 |
T |
 |
| Q |
117 |
cctctttgtcttgttcaatattctaaacaaagagtataaataaataacttctacatcatgttgcttgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762682 |
cctctttgtcttgttcaatattctaaacaaagagtataaataaataacttctacatcatgttgcttgt |
38762749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University