View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_high_23 (Length: 479)
Name: NF11635_high_23
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 18 - 471
Target Start/End: Complemental strand, 5982705 - 5982261
Alignment:
| Q |
18 |
tgcatatccagcatgttgaggttggtaccaaggcattggtggtggacgatatcctgagaatggttgataccctgacattggtggtgagaatggtcggtac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982705 |
tgcatatccagcatgttgaggttggtaccaaggcattggtggtggacgatatcctgagaatggttgataccctgacattggtggtgagaatggtcggtac |
5982606 |
T |
|
| Q |
118 |
cctgacattggtggtgggcctggtggcggtggtcgatatccagcaaacggtggttggggtccgggttgatatccagcaaatggtggtgggggtgcgcgat |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982605 |
cctgacattggtggtgg---------cggtggtcgatatccagcaaacggtggttggggtccgggttgatatccagcaaatggtggtgggggtgcgcgat |
5982515 |
T |
|
| Q |
218 |
ggtttccagcagtcggtggtggttgcgcgtgttggtgtccagcagccggtcgtggttgtgcatgttgattaccaaaatcaaacatgttattttggtcatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5982514 |
ggtttccagcagtcggtggtggttgcgcgtgttggtgtccagcagccggtcgtggttgtgcatgttgattacgaaaatcaaacatgttattttggtcatg |
5982415 |
T |
|
| Q |
318 |
cattttgttgctcctttgattgtgatgtgtcttatgattatgaccataaacatgtttggcttcatactcctcctcagtgtcactactctcatgacaccga |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982414 |
cattttgttgctcctttgattgtgatgtgtcttatgattatgaccataaacttgtttggcttcatactcctcctcagtgtcactactctcatgacaccga |
5982315 |
T |
|
| Q |
418 |
cgagaatgatgcttcttttttgcatgagaaccagctcctttttcctttgcttct |
471 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5982314 |
cgagaatgatgcttcttttttgcatgagaaccagctcctttttcctttggttct |
5982261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University