View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_high_54 (Length: 316)
Name: NF11635_high_54
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_high_54 |
 |  |
|
| [»] scaffold0126 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0126 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 24846 - 24531
Alignment:
| Q |
1 |
gtgagctaagagcagcactagatgaacatttgcatgaaaatgagcttaggttatatgtggaaaattgtttggctcactatgatcaagtaattaacctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24846 |
gtgagctaagagcagcactagatgaacatttgcatgaaaatgagcttaggttatatgtggaaaattgtttggctcactatgatcaagtaattaacctcaa |
24747 |
T |
 |
| Q |
101 |
aaatattctagctagaacagatgtgttccatcttgtttttggaatgtggaaaaccccagctgaacgttgcttcatgtggattggtggattcagaccatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24746 |
aaatattctagctagaacagatgtgttccatcttgtttttggaatgtggaaaaccccagctgaacgttgcttcatgtggattggtggattcagaccatct |
24647 |
T |
 |
| Q |
201 |
gaactcattaaggtaaacaaatgttgcatcaatgatcaacctagccttatagaaatattggttttaaattgccgttacagtcagggtcggcccaatgggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24646 |
gaactcattaaggtaaacaaatgttgcatcaatgatcaacctagccttatagaaatattggttttaaattgcagttacagtcagggtcggcccaatgggt |
24547 |
T |
 |
| Q |
301 |
gtgcaaggtgagccac |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24546 |
gtgcaaggtgagccac |
24531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 24433 - 24387
Alignment:
| Q |
270 |
tgccgttacagtcagggtcggcccaatgggtgtgcaaggtgagccac |
316 |
Q |
| |
|
|||| |||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
24433 |
tgccattaccgtcagggttggcgcaatgggtgtgcaaggtgagccac |
24387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 129 - 215
Target Start/End: Complemental strand, 36798092 - 36798006
Alignment:
| Q |
129 |
catcttgtttttggaatgtggaaaaccccagctgaacgttgcttcatgtggattggtggattcagaccatctgaactcattaaggta |
215 |
Q |
| |
|
|||||||||| ||| |||||| |||||| |||||||||||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
36798092 |
catcttgtttctggcatgtgggttaccccaattgaacgttgcttcatgtggattggtggatttaagccttctgaactcattaaggta |
36798006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University