View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_high_74 (Length: 239)
Name: NF11635_high_74
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_high_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 42092774 - 42092553
Alignment:
| Q |
10 |
aaaaaccatttgtatggtgaattatgtcccacttataa-ttactagtcatactatat----tattgtactacattggactcttaagtctcaagagttcat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092774 |
aaaaaccatttgtatggtgaattatgtcccacttataaattactagtcatactatatatattattgtactacattggactcttaagtctcaagagttcat |
42092675 |
T |
|
| Q |
105 |
atggacgg----cgtgattgatgatttctaaatttagttttagaaagaaacggttggggattatttgagccaaatccaaaggctttcatta-tttgcaaa |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
42092674 |
atggacggacggcgtgattgatgatttctaaatttagttttagaaagaaacggttggggattatttgagccaaatccaaaggc-ttcattattttgcaaa |
42092576 |
T |
|
| Q |
200 |
gtatatgagacatattggccatg |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42092575 |
gtatatgagacatattggccatg |
42092553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University