View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_high_80 (Length: 202)
Name: NF11635_high_80
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_high_80 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 4e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 2274429 - 2274531
Alignment:
| Q |
18 |
cacagagcttcatttggtgaatataggttgacgactcttttgtttgtactttgactgaataggttgcgacttaaataggtgtgtgcagtaacaaacatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2274429 |
cacagagcttcatttggtgaatataggttgacgactcttttgtttgtactttgactggataggttgcgacttaaataggtgtgtgcagtaacaaacatca |
2274528 |
T |
|
| Q |
118 |
cag |
120 |
Q |
| |
|
||| |
|
|
| T |
2274529 |
cag |
2274531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 2272873 - 2272950
Alignment:
| Q |
18 |
cacagagcttcatttggtgaatataggttgacgactcttttgtttgtactttgactgaataggttgcgacttaaatag |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2272873 |
cacagagcttcatttggtgaatataggttgacgactcttttgtttgtactttgactgaataggttgcgacttaaatag |
2272950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University