View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_low_29 (Length: 444)
Name: NF11635_low_29
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 431
Target Start/End: Original strand, 19210716 - 19211144
Alignment:
| Q |
18 |
gtttcaataaggaaaaggaaaatcatgataataatattttgtatacatgttgatggtaaaggagaagaagcttataaattatacggcaatgagatgaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19210716 |
gtttcaataaggaaaaggaaaatcatgataataatattttgtatacatgttgatggtaaaggagaagaagcttataaattatacggcaatgagatgaaat |
19210815 |
T |
 |
| Q |
118 |
gctaatatagattcagttcttatgcttttttatatcccttggtcttgctcttatttcttattgtcaactgtgttttgggtatactcacactca------- |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19210816 |
gctaatataggttcagttcttatgcttttt-atatctcttggtcttgctcttatttattattgtcaactgtgttttgggtatactcacactcatgagaag |
19210914 |
T |
 |
| Q |
211 |
---------cgatgatgaatgaacgaaaaaacgaataaatctgatgatcatattatgaaatctaatttatgtgaatgtcccttttgggaatactttgtgg |
301 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19210915 |
ttgcaaacacgatgatgaatgaacgaaaaaactaataaatctgatgatcatattatgaaatctaatttatgtgaatgtcctttttgggaatactttgtgg |
19211014 |
T |
 |
| Q |
302 |
gtagtgaattgtaagtggtgtggtttgcccgtgtccgtggggtgcgtgtcctaaacgggccgactctacacaccttatatcgttgcactgatgataaaca |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||| |||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
19211015 |
gtagtgaattgtaagtggtgtggtttgcccatgtccgtggggcgcttgtcctaaacgggccaactctacacattttatatcgttgcgttgatgatgaaca |
19211114 |
T |
 |
| Q |
402 |
gttgtgtttgttggtgatgtttggatgatg |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19211115 |
gttgtgtttgttggtgatgtttggatgatg |
19211144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University