View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_low_60 (Length: 300)
Name: NF11635_low_60
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 14065823 - 14066108
Alignment:
| Q |
1 |
tgaacgagcaatctgatgctcattaatgaacgaaggagaggttttgcggtattaatacatgagaaatcagctactaactgtcataactgaaaagctagaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065823 |
tgaatgagcaatctgatgctcattaatgaacgaaggagaggttttgcggtattaatacatgagaaatcagctactaactgtcataactgaaaagctagaa |
14065922 |
T |
|
| Q |
101 |
atgcgggaaattcataactaactgatactgctagataactaactaacaggttgctaatcacttatcattgctacttatcaggttaatcttcacagcttat |
200 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065923 |
atgcgggaaattcataactaactaaaactgctagataactaactaacaggttgctaatcacttatcattgctacttatcaggttaatcttcacagcttat |
14066022 |
T |
|
| Q |
201 |
caagacacatcaaaataaggtggttcacccaatttggactatgtctataggaaacaacaaatttcactatatgaaatgtgaacaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14066023 |
caagacacatcaaaataaggtggttcacccaatttggactatgtctataggaaacaacaaatttcactatatgaaatgtgaacaat |
14066108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University