View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_low_68 (Length: 268)
Name: NF11635_low_68
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 4332596 - 4332355
Alignment:
| Q |
10 |
agaagaagcaggaaaaacggtttcaacaaccatagcatccatcccagcctgaacatgttcatcagcaacttcaccaccatcagcggccgcagccgtaacc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4332596 |
agaagaagcaggaaaaacggtttcaacaaccatagcatccatcccagcctgaacatgttcatcagcaacttcaccaccatcagcggccgcagccgtaacc |
4332497 |
T |
 |
| Q |
110 |
gcctgacggaaatcaacagctccgacgagagtgagttgagacaaatcattctcgaatgttcttacacacgggagttgcttttggtctgaggaatcggaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4332496 |
gcctgacggaaatcaacagctccgacgagagtgagttgagacaaatcattctcgaatgttcttacacacgggagttgcttttggtctgaggaatcggaaa |
4332397 |
T |
 |
| Q |
210 |
ttgcttgcagaaattgttgctcggtgactggaattgtctttg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4332396 |
ttgcttgcagaaattgttgctcggtgactggaattgtctttg |
4332355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University