View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_low_70 (Length: 250)
Name: NF11635_low_70
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 2 - 241
Target Start/End: Original strand, 42092794 - 42093033
Alignment:
| Q |
2 |
aattaatttttatgatggtacaaagtccgtcttaaatttgttggacaccattattaatacctttcaacaactctaaccatgcaagtcctttttatagagt |
101 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092794 |
aattaatttttatgatggtacaaagtctgtcttaaatttgttggacaccattattaatacctttcaacaactctaaccatgcaagtcctttttatagagt |
42092893 |
T |
 |
| Q |
102 |
tgagttattatcgtattaagatggtttgcacaaaatagaaaatatactgaactcaaatttgaagaggcacatttgtttttattattattataatttgtcc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092894 |
tgagttattatcgtattaagatggtttgcacataatagaaaaaatactgaactcaaatttgaagaggcacatttgtttttattattattataatttgtcc |
42092993 |
T |
 |
| Q |
202 |
ttgcttgatatttatgctgtctcattactgggccctatgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42092994 |
ttgcttgatatttatgctgtctcattactgggccccatgc |
42093033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University