View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_low_72 (Length: 242)
Name: NF11635_low_72
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 25078963 - 25079183
Alignment:
| Q |
1 |
actgctataaaagcaaaaacagcagctatacttatcttcaccctctttgcttcatttggtctgaactttttcaaatcaaaatgccaaagaagcctgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25078963 |
actgctataaaagcaaaaacagcagctatacttatcttcaccctctttgcttcatttggtctgaactttttcaaatcaaaatgccaaagaagcctgttat |
25079062 |
T |
|
| Q |
101 |
gttaacatgtacaatgattaattaattgttcgaaggtacaactgagttcgagcaaatatatatgtgacagatatacaaatacataccagtgagctataga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25079063 |
gttaacatgtacaatgattaattaattgttcgaaggtacaattgagttcgagcaaatatatatgtgacagatatacaaatacataccagtgagctataga |
25079162 |
T |
|
| Q |
201 |
catcaaaggacgcaatggacc |
221 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
25079163 |
catccaaggacgcaatggacc |
25079183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 80
Target Start/End: Original strand, 54619537 - 54619614
Alignment:
| Q |
3 |
tgctataaaagcaaaaacagcagctatacttatcttcaccctctttgcttcatttggtctgaactttttcaaatcaaa |
80 |
Q |
| |
|
||||||||| || |||||| ||| | ||||||||||||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
54619537 |
tgctataaaggcgaaaacacaagccaaacttatcttcaccctctttatttcatttggtctgaacgtcttcaaatcaaa |
54619614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University